grna sequence 2 Search Results


90
GenScript corporation fbxl4 crispr grna plasmid
Expression of dominant‐negative ( DN ) Cullin 1 results in an increase in the levels and half‐life of NIX and BNIP3 . HeLa‐T‐REx‐Flp‐in cells were transfected with FLAG‐HA‐tagged dominant‐negative CUL1, CUL3, CUL4A and CUL5 or an empty vector. Cells were treated with cycloheximide for 3 h followed by immunoblotting with the indicated antibodies. Expression of dominant‐negative ( DN ) Cullin 1 results in the accumulation of NIX and BNIP3 at mitochondria . U2OS cells were transfected with FLAG‐HA‐tagged DN‐CUL1 or FLAG‐HA‐tagged DN‐CUL4 and immunostained for both HA and either NIX or BNIP3. An orange line marks the edge of the individual cells expressing the dominant‐negative cullin protein. Screen for F‐box proteins required for turnover of NIX and BNIP3 . U2OS cells were transfected with the indicated siRNAs. Total‐cell lysates were subject to immunoblotting as shown. NIX and BNIP3 are stabilised by depletion of CUL1 and <t>FBXL4</t> (but not other F‐box proteins). NT = non‐targeting. NIX and BNIP3 are upregulated and stabilised by depletion of FBXL4 and CUL1 . U2OS cells were transfected with non‐targeting siRNA, CUL1 siRNA or FBXL4 siRNA. Cells were treated with cycloheximide for the indicated times prior to immunoblotting with the specified antibodies. Depletion of FBXL4 and CUL1 results in NIX and BNIP3 accumulation at mitochondria . U2OS cells were transfected with non‐targeting siRNA, CUL1 siRNA or FBXL4 siRNA. Cells were fixed and stained with the indicated antibodies. Evaluation of the efficacy of FBXL4 siRNA to reduce exogenous HA‐tagged FBXL4 protein levels . U2OS FBXL4 knockout cells (which are described in Fig and Table ) constitutively expressing FBXL4‐HA (FBXL4 tagged with C‐terminal HA) were transfected with non‐targeting siRNA or FBXL4 siRNA. Immunoblotting was performed as indicated. U2OS cells were transfected with non‐targeting siRNA or FBXL4 siRNA and the efficiency of FBXL4 siRNA was evaluated using quantitative‐PCR. Bars represent the mean ± SD from three independent transfections. Data information: Scale bars = 20 μm.
Fbxl4 Crispr Grna Plasmid, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/grna+sequence+2/fbxl4+crispr+grna+plasmids/pmc10308361-157-38-18
Average 90 stars, based on 1 article reviews
fbxl4 crispr grna plasmid - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
Addgene inc gcn2 eif2ak4 guide rna sequence 2
(A) Representative western blots for puromycin and S6K in HEK293T cells after (+ puro) or without (− puro) a pulse of 10 μg/mL puromycin following 3 hours of leucine or arginine limitation, treatment with 250 nM Torin1, or growth in rich medium. Bar graph shows puromycin incorporation relative to rich medium (calculated as described in Methods); error bars represent the standard error of the mean from three technical replicate experiments. (B) Puromycin incorporation in HEK293T cells following 1.5, 3, 6, or 12 hours of leucine or arginine limitation, relative to rich medium. (C) Polysome profiles from HEK293T (WT) cells following 6 hours of leucine or arginine limitation or growth in rich medium. The main plot shows overlaid polysome profiles starting at the disome (2 ribosome) peak and the inset plots show the entire profile, aligned with respect to the monosome peak height along the y-axis and position along the x-axis. (D) Puromycin incorporation in WT or <t>GCN2</t> KO cell lines following 3 hours of leucine or arginine limitation, relative to rich medium (calculated as in described in Methods, see S5G for representative blots). Error bars represent the standard error of the mean for three technical replicates. (E) Polysome profiles (as described in C) from the GCN2 KO cell line following 6 hours of limitation for leucine or arginine or growth in rich medium.
Gcn2 Eif2ak4 Guide Rna Sequence 2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/grna+sequence+2/EIF2AK4+gRNA+(BRDN0001146469)+(Plasmid+%2375876)/pmc06516488-121-11-20
Average 90 stars, based on 1 article reviews
gcn2 eif2ak4 guide rna sequence 2 - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
Addgene inc eef2k guide rna sequence 2
KEY RESOURCES TABLE :
Eef2k Guide Rna Sequence 2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/grna+sequence+2/EEF2K+gRNA+(BRDN0001146991)+(Plasmid+%2377855)/pmc06516488-123-11-19
Average 90 stars, based on 1 article reviews
eef2k guide rna sequence 2 - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

Image Search Results


Expression of dominant‐negative ( DN ) Cullin 1 results in an increase in the levels and half‐life of NIX and BNIP3 . HeLa‐T‐REx‐Flp‐in cells were transfected with FLAG‐HA‐tagged dominant‐negative CUL1, CUL3, CUL4A and CUL5 or an empty vector. Cells were treated with cycloheximide for 3 h followed by immunoblotting with the indicated antibodies. Expression of dominant‐negative ( DN ) Cullin 1 results in the accumulation of NIX and BNIP3 at mitochondria . U2OS cells were transfected with FLAG‐HA‐tagged DN‐CUL1 or FLAG‐HA‐tagged DN‐CUL4 and immunostained for both HA and either NIX or BNIP3. An orange line marks the edge of the individual cells expressing the dominant‐negative cullin protein. Screen for F‐box proteins required for turnover of NIX and BNIP3 . U2OS cells were transfected with the indicated siRNAs. Total‐cell lysates were subject to immunoblotting as shown. NIX and BNIP3 are stabilised by depletion of CUL1 and FBXL4 (but not other F‐box proteins). NT = non‐targeting. NIX and BNIP3 are upregulated and stabilised by depletion of FBXL4 and CUL1 . U2OS cells were transfected with non‐targeting siRNA, CUL1 siRNA or FBXL4 siRNA. Cells were treated with cycloheximide for the indicated times prior to immunoblotting with the specified antibodies. Depletion of FBXL4 and CUL1 results in NIX and BNIP3 accumulation at mitochondria . U2OS cells were transfected with non‐targeting siRNA, CUL1 siRNA or FBXL4 siRNA. Cells were fixed and stained with the indicated antibodies. Evaluation of the efficacy of FBXL4 siRNA to reduce exogenous HA‐tagged FBXL4 protein levels . U2OS FBXL4 knockout cells (which are described in Fig and Table ) constitutively expressing FBXL4‐HA (FBXL4 tagged with C‐terminal HA) were transfected with non‐targeting siRNA or FBXL4 siRNA. Immunoblotting was performed as indicated. U2OS cells were transfected with non‐targeting siRNA or FBXL4 siRNA and the efficiency of FBXL4 siRNA was evaluated using quantitative‐PCR. Bars represent the mean ± SD from three independent transfections. Data information: Scale bars = 20 μm.

Journal: The EMBO Journal

Article Title: FBXL4 suppresses mitophagy by restricting the accumulation of NIX and BNIP3 mitophagy receptors

doi: 10.15252/embj.2022112767

Figure Lengend Snippet: Expression of dominant‐negative ( DN ) Cullin 1 results in an increase in the levels and half‐life of NIX and BNIP3 . HeLa‐T‐REx‐Flp‐in cells were transfected with FLAG‐HA‐tagged dominant‐negative CUL1, CUL3, CUL4A and CUL5 or an empty vector. Cells were treated with cycloheximide for 3 h followed by immunoblotting with the indicated antibodies. Expression of dominant‐negative ( DN ) Cullin 1 results in the accumulation of NIX and BNIP3 at mitochondria . U2OS cells were transfected with FLAG‐HA‐tagged DN‐CUL1 or FLAG‐HA‐tagged DN‐CUL4 and immunostained for both HA and either NIX or BNIP3. An orange line marks the edge of the individual cells expressing the dominant‐negative cullin protein. Screen for F‐box proteins required for turnover of NIX and BNIP3 . U2OS cells were transfected with the indicated siRNAs. Total‐cell lysates were subject to immunoblotting as shown. NIX and BNIP3 are stabilised by depletion of CUL1 and FBXL4 (but not other F‐box proteins). NT = non‐targeting. NIX and BNIP3 are upregulated and stabilised by depletion of FBXL4 and CUL1 . U2OS cells were transfected with non‐targeting siRNA, CUL1 siRNA or FBXL4 siRNA. Cells were treated with cycloheximide for the indicated times prior to immunoblotting with the specified antibodies. Depletion of FBXL4 and CUL1 results in NIX and BNIP3 accumulation at mitochondria . U2OS cells were transfected with non‐targeting siRNA, CUL1 siRNA or FBXL4 siRNA. Cells were fixed and stained with the indicated antibodies. Evaluation of the efficacy of FBXL4 siRNA to reduce exogenous HA‐tagged FBXL4 protein levels . U2OS FBXL4 knockout cells (which are described in Fig and Table ) constitutively expressing FBXL4‐HA (FBXL4 tagged with C‐terminal HA) were transfected with non‐targeting siRNA or FBXL4 siRNA. Immunoblotting was performed as indicated. U2OS cells were transfected with non‐targeting siRNA or FBXL4 siRNA and the efficiency of FBXL4 siRNA was evaluated using quantitative‐PCR. Bars represent the mean ± SD from three independent transfections. Data information: Scale bars = 20 μm.

Article Snippet: The pSpCas9 BB‐2A‐Puro (PX459) plasmid backbone was used to create the following guide RNA (gRNA) plasmids (created by Genscript ® ): BNIP3 CRISPR gRNA plasmid (gRNA targeting sequence: TCTTGTGGTGTCTGCGAGCG), NIX CRISPR gRNA plasmid (gRNA targeting sequence: TAGCTCTCAGGTGTGTCGGG) and FBXL4 CRISPR gRNA plasmids (gRNA targeting sequence: CAATTCAAGGCGTACTAATT; gRNA targeting sequence 2: CCCCACAAATCTTATACGAC).

Techniques: Expressing, Dominant Negative Mutation, Transfection, Plasmid Preparation, Western Blot, Staining, Knock-Out, Real-time Polymerase Chain Reaction

NIX and BNIP3 are upregulated and stabilised in CRISPR–Cas9 generated FBXL4‐deficient cells . CRISPR‐mediated genome editing was used to modify the FBXL4 locus in U2OS cells. Clonal cell lines lacking FBXL4 were treated with cycloheximide for the indicated times prior to immunoblotting. NIX and BNIP3 accumulate at mitochondria in FBXL4‐deficient cells . FBXL4‐deficient cells (clone 2G10) were fixed and stained with MitoTracker (magenta) and with antibodies to NIX or BNIP3 (green). Scale bar = 10 μm. Re‐expression of FBXL4 into FBXL4‐defective CRISPR lines reduces the levels of NIX and BNIP3 in FBLX4‐deficient clones . FBXL4‐deficient 2G10 and FBXL4‐deficient 1D4 cell lines were stably transduced with a doxycycline‐inducible FBXL4‐HA construct. Cells were treated with doxycycline for the indicated times prior to immunoblotting with the specified antibodies. FBXL4 requires its mitochondrial targeting sequence and F‐box domain to mediate NIX and BNIP3 turnover . U2OS FBXL4 KO (2G10) cells were rescued with wild‐type FBXL4‐HA or variants lacking either the mitochondrial targeting sequence (FBXL4‐ΔMTS) or the F‐box domain (FBXL4‐F‐box mut) variants. Cells were treated with cycloheximide for 3 h prior to harvesting. FBXL4 localises to the mitochondrial outer membrane . Cells transiently transfected with FBXL4‐HA‐C were treated with DFP for 24 h. Cells were stained with an anti‐HA antibody (to recognise FBXL4) and either TOM20 (an outer mitochondrial membrane protein) or TIM50 (an inner mitochondrial membrane protein). The line scan intensity profiles for FBXL4 (green) and TOM20/TIM50 (magenta) represent fluorescence intensity ( y ‐axis) plotted against distance ( x ‐axis). Scale bars = 5 μm. FBXL4 is a proximity interactor of NIX and BNIP3 . Cells expressing inducible BirA‐BNIP3, BirA‐NIX and BirA control were transduced with a lentiviral vector expressing FBXL4, as indicated. Cells were treated with doxycycline for 48 h (to induce BirA‐bait protein expression), biotin for 24 h (for the biotinylation reaction) and, where indicated, MLN4924 for 24 h (to stabilise NIX and BNIP3). Streptavidin‐coupled beads were used to capture the biotinylated proteins. FBXL4 was specifically detected in the eluate from BirA‐BNIP3 and BirA‐NIX compared with BirA‐alone. NIX and BNIP3 polyubiquitylation depend on FBXL4 . U2OS or U2OS‐FBXL4 KO cells were co‐transfected with TR‐TUBE and either myc‐BNIP3 or myc‐NIX, as indicated. Cell lysates obtained 48 h post‐transfection were immunoprecipitated with anti‐FLAG beads, and the immunoprecipitates were analysed by immunoblotting using anti‐myc antibody (to detect ubiquitylated NIX or BNIP3). The line on the right marks a ladder of bands corresponding to polyubiquitylated myc‐BNIP3 or myc‐NIX. Source data are available online for this figure.

Journal: The EMBO Journal

Article Title: FBXL4 suppresses mitophagy by restricting the accumulation of NIX and BNIP3 mitophagy receptors

doi: 10.15252/embj.2022112767

Figure Lengend Snippet: NIX and BNIP3 are upregulated and stabilised in CRISPR–Cas9 generated FBXL4‐deficient cells . CRISPR‐mediated genome editing was used to modify the FBXL4 locus in U2OS cells. Clonal cell lines lacking FBXL4 were treated with cycloheximide for the indicated times prior to immunoblotting. NIX and BNIP3 accumulate at mitochondria in FBXL4‐deficient cells . FBXL4‐deficient cells (clone 2G10) were fixed and stained with MitoTracker (magenta) and with antibodies to NIX or BNIP3 (green). Scale bar = 10 μm. Re‐expression of FBXL4 into FBXL4‐defective CRISPR lines reduces the levels of NIX and BNIP3 in FBLX4‐deficient clones . FBXL4‐deficient 2G10 and FBXL4‐deficient 1D4 cell lines were stably transduced with a doxycycline‐inducible FBXL4‐HA construct. Cells were treated with doxycycline for the indicated times prior to immunoblotting with the specified antibodies. FBXL4 requires its mitochondrial targeting sequence and F‐box domain to mediate NIX and BNIP3 turnover . U2OS FBXL4 KO (2G10) cells were rescued with wild‐type FBXL4‐HA or variants lacking either the mitochondrial targeting sequence (FBXL4‐ΔMTS) or the F‐box domain (FBXL4‐F‐box mut) variants. Cells were treated with cycloheximide for 3 h prior to harvesting. FBXL4 localises to the mitochondrial outer membrane . Cells transiently transfected with FBXL4‐HA‐C were treated with DFP for 24 h. Cells were stained with an anti‐HA antibody (to recognise FBXL4) and either TOM20 (an outer mitochondrial membrane protein) or TIM50 (an inner mitochondrial membrane protein). The line scan intensity profiles for FBXL4 (green) and TOM20/TIM50 (magenta) represent fluorescence intensity ( y ‐axis) plotted against distance ( x ‐axis). Scale bars = 5 μm. FBXL4 is a proximity interactor of NIX and BNIP3 . Cells expressing inducible BirA‐BNIP3, BirA‐NIX and BirA control were transduced with a lentiviral vector expressing FBXL4, as indicated. Cells were treated with doxycycline for 48 h (to induce BirA‐bait protein expression), biotin for 24 h (for the biotinylation reaction) and, where indicated, MLN4924 for 24 h (to stabilise NIX and BNIP3). Streptavidin‐coupled beads were used to capture the biotinylated proteins. FBXL4 was specifically detected in the eluate from BirA‐BNIP3 and BirA‐NIX compared with BirA‐alone. NIX and BNIP3 polyubiquitylation depend on FBXL4 . U2OS or U2OS‐FBXL4 KO cells were co‐transfected with TR‐TUBE and either myc‐BNIP3 or myc‐NIX, as indicated. Cell lysates obtained 48 h post‐transfection were immunoprecipitated with anti‐FLAG beads, and the immunoprecipitates were analysed by immunoblotting using anti‐myc antibody (to detect ubiquitylated NIX or BNIP3). The line on the right marks a ladder of bands corresponding to polyubiquitylated myc‐BNIP3 or myc‐NIX. Source data are available online for this figure.

Article Snippet: The pSpCas9 BB‐2A‐Puro (PX459) plasmid backbone was used to create the following guide RNA (gRNA) plasmids (created by Genscript ® ): BNIP3 CRISPR gRNA plasmid (gRNA targeting sequence: TCTTGTGGTGTCTGCGAGCG), NIX CRISPR gRNA plasmid (gRNA targeting sequence: TAGCTCTCAGGTGTGTCGGG) and FBXL4 CRISPR gRNA plasmids (gRNA targeting sequence: CAATTCAAGGCGTACTAATT; gRNA targeting sequence 2: CCCCACAAATCTTATACGAC).

Techniques: CRISPR, Generated, Western Blot, Staining, Expressing, Clone Assay, Stable Transfection, Transduction, Construct, Sequencing, Membrane, Transfection, Fluorescence, Control, Plasmid Preparation, Immunoprecipitation

Loss of FBXL4 leads to an increase in mitophagy , which can be reduced by re‐expression of FBXL4 . U2OS mt‐Keima FBXL4 KO clones (2G10 and 1D4) expressing doxycycline‐inducible wild‐type FBXL4‐HA were treated with doxycycline for 72 h. The emission signals obtained after excitation with the 458 nm laser (neutral pH) or 561 nm laser (acidic pH) are shown in green and magenta respectively. Quantification of mitophagy shown in panel A . Mitophagy is represented as the ratio of mt‐Keima 561 nm fluorescence intensity divided by mt‐Keima 458 nm fluorescence intensity for individual cells normalised to the parental condition. Corresponding cells from (A, B) were harvested for immunoblotting to analyse the extent of NIX and BNIP3 reduction by induction of FBXL4‐HA. Depleting NIX/BNIP3 via siRNA reduces the increased mitophagy caused by FBXL4 deficiency . U2OS mt‐Keima cells and U2OS mt‐Keima FBXL4 KO 2G10 cells were transfected with siRNAs targeting both NIX and BNIP3 (NIX/BNIP3 si) or non‐targeting siRNA (NT si). UT, untransfected. Quantification of (D). Corresponding cells from (D, E) were harvested for immunoblotting to analyse the extent of NIX and BNIP3 reduction after siRNA transfection. Hyper‐stable NIX deletion mutants increase mitophagy compared with wild‐type NIX . Hela Flp‐in NIX KO mt‐Keima cells stably expressing inducible NIX(WT), FLAG‐NIXΔ151‐170 or FLAG‐NIXΔ171‐184 were treated with doxycycline for 48 h (see Fig , top panel). Mitophagy was visualised as in (A) and quantified as in (B). Hyper‐stable BNIP3 deletion mutants increase mitophagy compared with wild‐type NIX . Hela Flp‐in NIX/BNIP3 DKO mt‐Keima cells stably expressing BNIP3 deletion mutants were treated with doxycycline for 48 h (see Fig , bottom panel). Data information: In (B, E, G and H), translucent grey dots represent measurements from individual cells. Coloured circles represent the mean ratio from independent experiments. The centre lines and bars represent the mean of the independent replicate means ± SD. N = 3. At least 200 cells were analysed per condition. P values were calculated based on the mean values using a one‐way ANOVA (* P < 0.05, ** P < 0.005, *** P < 0.001, **** P < 0.0001). Scale bars = 20 μm. Source data are available online for this figure.

Journal: The EMBO Journal

Article Title: FBXL4 suppresses mitophagy by restricting the accumulation of NIX and BNIP3 mitophagy receptors

doi: 10.15252/embj.2022112767

Figure Lengend Snippet: Loss of FBXL4 leads to an increase in mitophagy , which can be reduced by re‐expression of FBXL4 . U2OS mt‐Keima FBXL4 KO clones (2G10 and 1D4) expressing doxycycline‐inducible wild‐type FBXL4‐HA were treated with doxycycline for 72 h. The emission signals obtained after excitation with the 458 nm laser (neutral pH) or 561 nm laser (acidic pH) are shown in green and magenta respectively. Quantification of mitophagy shown in panel A . Mitophagy is represented as the ratio of mt‐Keima 561 nm fluorescence intensity divided by mt‐Keima 458 nm fluorescence intensity for individual cells normalised to the parental condition. Corresponding cells from (A, B) were harvested for immunoblotting to analyse the extent of NIX and BNIP3 reduction by induction of FBXL4‐HA. Depleting NIX/BNIP3 via siRNA reduces the increased mitophagy caused by FBXL4 deficiency . U2OS mt‐Keima cells and U2OS mt‐Keima FBXL4 KO 2G10 cells were transfected with siRNAs targeting both NIX and BNIP3 (NIX/BNIP3 si) or non‐targeting siRNA (NT si). UT, untransfected. Quantification of (D). Corresponding cells from (D, E) were harvested for immunoblotting to analyse the extent of NIX and BNIP3 reduction after siRNA transfection. Hyper‐stable NIX deletion mutants increase mitophagy compared with wild‐type NIX . Hela Flp‐in NIX KO mt‐Keima cells stably expressing inducible NIX(WT), FLAG‐NIXΔ151‐170 or FLAG‐NIXΔ171‐184 were treated with doxycycline for 48 h (see Fig , top panel). Mitophagy was visualised as in (A) and quantified as in (B). Hyper‐stable BNIP3 deletion mutants increase mitophagy compared with wild‐type NIX . Hela Flp‐in NIX/BNIP3 DKO mt‐Keima cells stably expressing BNIP3 deletion mutants were treated with doxycycline for 48 h (see Fig , bottom panel). Data information: In (B, E, G and H), translucent grey dots represent measurements from individual cells. Coloured circles represent the mean ratio from independent experiments. The centre lines and bars represent the mean of the independent replicate means ± SD. N = 3. At least 200 cells were analysed per condition. P values were calculated based on the mean values using a one‐way ANOVA (* P < 0.05, ** P < 0.005, *** P < 0.001, **** P < 0.0001). Scale bars = 20 μm. Source data are available online for this figure.

Article Snippet: The pSpCas9 BB‐2A‐Puro (PX459) plasmid backbone was used to create the following guide RNA (gRNA) plasmids (created by Genscript ® ): BNIP3 CRISPR gRNA plasmid (gRNA targeting sequence: TCTTGTGGTGTCTGCGAGCG), NIX CRISPR gRNA plasmid (gRNA targeting sequence: TAGCTCTCAGGTGTGTCGGG) and FBXL4 CRISPR gRNA plasmids (gRNA targeting sequence: CAATTCAAGGCGTACTAATT; gRNA targeting sequence 2: CCCCACAAATCTTATACGAC).

Techniques: Expressing, Clone Assay, Fluorescence, Western Blot, Transfection, Stable Transfection

FBXL4‐deficient cells are ultra‐sensitive to DFP‐induced mitophagy. U2OS mt‐Keima cells and U2OS mt‐Keima FBXL4 KO cells were treated with DFP at specified concentrations for 24 h and analysed by live‐cell confocal microscopy. The emission signals obtained after excitation with the 458 nm laser (neutral pH) or 561 nm laser (acidic pH) are shown in green and magenta respectively. Quantification of mitophagy shown in panel (A). Mitophagy is represented as the ratio of mt‐Keima 561 nm fluorescence intensity divided by mt‐Keima 458 nm fluorescence intensity for individual cells normalised to the parental condition. Corresponding conditions from (A, B) were harvested for immunoblotting to analyse levels of NIX and BNIP. Analysis of NIX and BNIP localisation in parental cells or FBXL4 KO cells treated with specified concentration of DFP. Quantification of the MT‐CO2 protein levels in parental or FBXL4 KO cells treated with DFP. Western blotting was used to assess MT‐CO2 levels remaining relative to parental untreated cells. Mitophagy induced by hyper‐stable NIX ( Δ151‐170 ) requires NIX's LC3 interaction domain . Hela Flp‐in Keima cells stably expressing inducible NIX(WT), NIX(Δ151‐170) or NIX (151–170, LIRmut) were treated with doxycycline for 48 h. Mitophagy was quantified as in (B). Data information: In (B and F), translucent grey dots represent measurements from individual cells. In (B), coloured circles represent the mean ratio from independent experiments ( N = 4 for Veh Ctrl conditions and N = 3 for other conditions) and the centre lines and bars represent the mean of the independent replicate means ± SD. In (E), the coloured circles represent the = densitometry values of MT‐CO2 normalised to VCL loading control from independent experiments. In (F), the centre lines and bars represent the mean of the individual cells ± SD ( N = 1, > 60 cells analysed). For (B), P values were calculated from the mean values from independent experiments using one‐way ANOVA; for (F), P values were calculated from the ratios of the individual cells (* P < 0.05, ** P < 0.005, *** P < 0.001, **** P < 0.0001). Scale bars = 20 μm. Source data are available online for this figure.

Journal: The EMBO Journal

Article Title: FBXL4 suppresses mitophagy by restricting the accumulation of NIX and BNIP3 mitophagy receptors

doi: 10.15252/embj.2022112767

Figure Lengend Snippet: FBXL4‐deficient cells are ultra‐sensitive to DFP‐induced mitophagy. U2OS mt‐Keima cells and U2OS mt‐Keima FBXL4 KO cells were treated with DFP at specified concentrations for 24 h and analysed by live‐cell confocal microscopy. The emission signals obtained after excitation with the 458 nm laser (neutral pH) or 561 nm laser (acidic pH) are shown in green and magenta respectively. Quantification of mitophagy shown in panel (A). Mitophagy is represented as the ratio of mt‐Keima 561 nm fluorescence intensity divided by mt‐Keima 458 nm fluorescence intensity for individual cells normalised to the parental condition. Corresponding conditions from (A, B) were harvested for immunoblotting to analyse levels of NIX and BNIP. Analysis of NIX and BNIP localisation in parental cells or FBXL4 KO cells treated with specified concentration of DFP. Quantification of the MT‐CO2 protein levels in parental or FBXL4 KO cells treated with DFP. Western blotting was used to assess MT‐CO2 levels remaining relative to parental untreated cells. Mitophagy induced by hyper‐stable NIX ( Δ151‐170 ) requires NIX's LC3 interaction domain . Hela Flp‐in Keima cells stably expressing inducible NIX(WT), NIX(Δ151‐170) or NIX (151–170, LIRmut) were treated with doxycycline for 48 h. Mitophagy was quantified as in (B). Data information: In (B and F), translucent grey dots represent measurements from individual cells. In (B), coloured circles represent the mean ratio from independent experiments ( N = 4 for Veh Ctrl conditions and N = 3 for other conditions) and the centre lines and bars represent the mean of the independent replicate means ± SD. In (E), the coloured circles represent the = densitometry values of MT‐CO2 normalised to VCL loading control from independent experiments. In (F), the centre lines and bars represent the mean of the individual cells ± SD ( N = 1, > 60 cells analysed). For (B), P values were calculated from the mean values from independent experiments using one‐way ANOVA; for (F), P values were calculated from the ratios of the individual cells (* P < 0.05, ** P < 0.005, *** P < 0.001, **** P < 0.0001). Scale bars = 20 μm. Source data are available online for this figure.

Article Snippet: The pSpCas9 BB‐2A‐Puro (PX459) plasmid backbone was used to create the following guide RNA (gRNA) plasmids (created by Genscript ® ): BNIP3 CRISPR gRNA plasmid (gRNA targeting sequence: TCTTGTGGTGTCTGCGAGCG), NIX CRISPR gRNA plasmid (gRNA targeting sequence: TAGCTCTCAGGTGTGTCGGG) and FBXL4 CRISPR gRNA plasmids (gRNA targeting sequence: CAATTCAAGGCGTACTAATT; gRNA targeting sequence 2: CCCCACAAATCTTATACGAC).

Techniques: Confocal Microscopy, Fluorescence, Western Blot, Concentration Assay, Stable Transfection, Expressing, Control

Schematic representation of domain structure of FBXL4 . Pathological variants tested herein are shown in red. Alphafold2 structural modelling of FBXL4 and its complex formation with SCF components SKP1 and CUL1 . Pathogenic variants of FBXL4 indicated in magenta spheres. The pale pink section of the LRRs represents the region deleted by the truncation deletions (Arg435). FBXL4 patient‐derived variants exhibit reduced efficiency compared to wild‐type FBXL4 in mediating the downregulation and destabilisation of NIX and BNIP3. U2OS FBXL4 KO (2G10) cells were rescued with constructs expressing wild‐type FBXL4‐HA, FBXL4(F‐box mut), FBXL4(ΔMTS) or specified patient variants. Cells were treated with cycloheximide for 3 h prior to harvesting. Samples were lysed, and immunoblotting was performed. GFP serves as a marker of transduction efficiency/transgene expression. EV = empty vector. FBXL4 patient‐derived variants exhibit reduced efficiency compared to wild‐type FBXL4 in suppressing mitophagy . U2OS mt‐Keima cells (parental), U2OS mt‐Keima FBXL4 KO cells and U2OS mt‐Keima FBXL4 KO cells rescued with the specified FBXL4 constructs were visualised using live cell confocal microscopy. Mitophagy is represented as the ratio of mt‐Keima 561 nm fluorescence intensity divided by mt‐Keima 458 nm fluorescence intensity for individual cells normalised to untreated U2OS cells. FBXL4‐Arg482Trp and FBXL4‐Gly568Ala patient variants are less efficient than FBXL4 wild‐type at assembling into a complex with SKP1 and CUL1. FBXL4‐KO cells expressing wild‐type FBXL4‐HA or FBXL4 variants were harvested and lysed. Whole‐cell extracts were subjected to immunoprecipitation (IP) with anti‐HA agarose beads and immunoblotting, as indicated. Expression of FBXL4‐HA into FBXL4‐deficient patient fibroblast cells causes down‐regulation of NIX and BNIP3 and extensive changes in mitochondrial morphology. FBXL4‐deficient patient fibroblasts (derived from patients harbouring homozygous non‐sense mutation in FBXL4 at pArg435*) were transduced with FBXL4‐HA construct. Cells were stained with MitoTracker, fixed and co‐immunostained with antibodies to HA (to detect FBXL4) and either NIX or BNIP3. Steady‐state protein levels after expression of FBXL4‐HA‐C in FBXL4‐deficient patient fibroblasts analysed by Western blotting. FBXL4‐deficient patient fibroblasts were transduced with FBXL4‐HA‐C. NIX/BNIP3 depletion mediated by siRNA reduces mitophagy in FBXL4‐deficient patient fibroblast cells . FBXL4‐deficient patient fibroblasts were transfected with siRNAs targeting both NIX and BNIP3 (NIX/BNIP3 si) or non‐targeting siRNA (NT si) (left). Live‐cell confocal microscopy was performed to visualise mitophagy, and quantification was performed as in D (middle). The siRNA‐mediated depletion of NIX and BNIP3 was evaluated by Western blotting (right). Ubiquitylation of endogenous NIX is restored upon expression of FBXL4 in patient‐derived cells . Patient‐derived fibroblasts were transfected with FLAG‐tagged TR‐TUBE, as indicated. FLAG‐tagged TUBE protein was affinity purified from the corresponding lysates using FLAG‐beads, and the precipitates were analysed by immunoblotting using antibodies to endogenous NIX. Data information: In (D and H), translucent grey dots represent measurements from individual cells. Coloured circles represent the mean ratio from independent experiments. The centre lines and bars represent the mean of the independent replicates ± SD. In (D), N = 5 for Arg482Trp and Gly568Ala variant, N = 3 for other conditions; in H, N = 3. Over 100 cells were analysed per condition. P values were calculated based on the mean values using a one‐way ANOVA (* P < 0.05, ** P < 0.005, *** P < 0.001, **** P < 0.0001). Scale bar = 20 μm. Source data are available online for this figure.

Journal: The EMBO Journal

Article Title: FBXL4 suppresses mitophagy by restricting the accumulation of NIX and BNIP3 mitophagy receptors

doi: 10.15252/embj.2022112767

Figure Lengend Snippet: Schematic representation of domain structure of FBXL4 . Pathological variants tested herein are shown in red. Alphafold2 structural modelling of FBXL4 and its complex formation with SCF components SKP1 and CUL1 . Pathogenic variants of FBXL4 indicated in magenta spheres. The pale pink section of the LRRs represents the region deleted by the truncation deletions (Arg435). FBXL4 patient‐derived variants exhibit reduced efficiency compared to wild‐type FBXL4 in mediating the downregulation and destabilisation of NIX and BNIP3. U2OS FBXL4 KO (2G10) cells were rescued with constructs expressing wild‐type FBXL4‐HA, FBXL4(F‐box mut), FBXL4(ΔMTS) or specified patient variants. Cells were treated with cycloheximide for 3 h prior to harvesting. Samples were lysed, and immunoblotting was performed. GFP serves as a marker of transduction efficiency/transgene expression. EV = empty vector. FBXL4 patient‐derived variants exhibit reduced efficiency compared to wild‐type FBXL4 in suppressing mitophagy . U2OS mt‐Keima cells (parental), U2OS mt‐Keima FBXL4 KO cells and U2OS mt‐Keima FBXL4 KO cells rescued with the specified FBXL4 constructs were visualised using live cell confocal microscopy. Mitophagy is represented as the ratio of mt‐Keima 561 nm fluorescence intensity divided by mt‐Keima 458 nm fluorescence intensity for individual cells normalised to untreated U2OS cells. FBXL4‐Arg482Trp and FBXL4‐Gly568Ala patient variants are less efficient than FBXL4 wild‐type at assembling into a complex with SKP1 and CUL1. FBXL4‐KO cells expressing wild‐type FBXL4‐HA or FBXL4 variants were harvested and lysed. Whole‐cell extracts were subjected to immunoprecipitation (IP) with anti‐HA agarose beads and immunoblotting, as indicated. Expression of FBXL4‐HA into FBXL4‐deficient patient fibroblast cells causes down‐regulation of NIX and BNIP3 and extensive changes in mitochondrial morphology. FBXL4‐deficient patient fibroblasts (derived from patients harbouring homozygous non‐sense mutation in FBXL4 at pArg435*) were transduced with FBXL4‐HA construct. Cells were stained with MitoTracker, fixed and co‐immunostained with antibodies to HA (to detect FBXL4) and either NIX or BNIP3. Steady‐state protein levels after expression of FBXL4‐HA‐C in FBXL4‐deficient patient fibroblasts analysed by Western blotting. FBXL4‐deficient patient fibroblasts were transduced with FBXL4‐HA‐C. NIX/BNIP3 depletion mediated by siRNA reduces mitophagy in FBXL4‐deficient patient fibroblast cells . FBXL4‐deficient patient fibroblasts were transfected with siRNAs targeting both NIX and BNIP3 (NIX/BNIP3 si) or non‐targeting siRNA (NT si) (left). Live‐cell confocal microscopy was performed to visualise mitophagy, and quantification was performed as in D (middle). The siRNA‐mediated depletion of NIX and BNIP3 was evaluated by Western blotting (right). Ubiquitylation of endogenous NIX is restored upon expression of FBXL4 in patient‐derived cells . Patient‐derived fibroblasts were transfected with FLAG‐tagged TR‐TUBE, as indicated. FLAG‐tagged TUBE protein was affinity purified from the corresponding lysates using FLAG‐beads, and the precipitates were analysed by immunoblotting using antibodies to endogenous NIX. Data information: In (D and H), translucent grey dots represent measurements from individual cells. Coloured circles represent the mean ratio from independent experiments. The centre lines and bars represent the mean of the independent replicates ± SD. In (D), N = 5 for Arg482Trp and Gly568Ala variant, N = 3 for other conditions; in H, N = 3. Over 100 cells were analysed per condition. P values were calculated based on the mean values using a one‐way ANOVA (* P < 0.05, ** P < 0.005, *** P < 0.001, **** P < 0.0001). Scale bar = 20 μm. Source data are available online for this figure.

Article Snippet: The pSpCas9 BB‐2A‐Puro (PX459) plasmid backbone was used to create the following guide RNA (gRNA) plasmids (created by Genscript ® ): BNIP3 CRISPR gRNA plasmid (gRNA targeting sequence: TCTTGTGGTGTCTGCGAGCG), NIX CRISPR gRNA plasmid (gRNA targeting sequence: TAGCTCTCAGGTGTGTCGGG) and FBXL4 CRISPR gRNA plasmids (gRNA targeting sequence: CAATTCAAGGCGTACTAATT; gRNA targeting sequence 2: CCCCACAAATCTTATACGAC).

Techniques: Derivative Assay, Construct, Expressing, Western Blot, Marker, Transduction, Plasmid Preparation, Confocal Microscopy, Fluorescence, Immunoprecipitation, Mutagenesis, Staining, Transfection, Affinity Purification, Variant Assay

Localisation of FBXL4 variants . FBXL4 KO cells expressing FBXL4‐HA wild‐type or specified variants were fixed and stained for HA (to detect FBXL4 in green) or TOM20 (in magenta). FBXL4 patient‐derived variants exhibit reduced efficiency in mediating the suppression of mitophagy compared to wild‐type FBXL4 . U2OS mt‐Keima cells, U2OS mt‐Keima FBXL4 KO cells and U2OS mt‐Keima FBXL4 KO cells rescued with FBXL4 constructs were analysed by confocal microscopy. The emission signals obtained after excitation with the 458 nm laser (neutral pH) or 561 nm laser (acidic pH) are shown in green and magenta respectively. Quantification of these conditions is shown in Fig . Elevated mitophagy in FBXL4 KO cells expressing FBXL4Arg435* truncation variant is reduced when NIX/BNIP3 are depleted using siRNA . FBXL4 KO cells stably expressing FBXL4Arg435* were transfected with siRNAs targeting both NIX and BNIP3 (NIX/BNIP3 si) or non‐targeting siRNA (NT si). Live‐cell confocal microscopy was performed to visualise mitophagy. Quantification of mitophagy shown in panel (C). Translucent grey dots represent measurements from individual cells. Coloured circles represent the mean ratio from independent experiments ( N = 2). The centre lines and bars represent the mean of the independent replicates ± SD. At least 50 cells were analysed per condition, and over 100 cells were analysed in total per condition. P values were calculated based on the mean values using a one‐way ANOVA (* P < 0.05, ** P < 0.005, *** P < 0.001, **** P < 0.0001). Evaluation of the extent of NIX/BNIP3 depletion in (C, D) using Western blotting. FBXL4Arg435* truncation variant is less efficient than wild‐type FBXL4 at promoting NIX ubiquitylation . Parental, FBXL4 KO cells, FBXL4 KO cells expressing either wild‐type FBXL4 or FBXL4‐Arg435* were transfected with TR‐TUBE and myc‐NIX, as indicated. Cell lysates obtained 48 h post‐transfection were immunoprecipitated with anti‐FLAG antibody, and the immunoprecipitates were analysed by immunoblotting using anti‐myc antibody (to detect ubiquitylated NIX or BNIP3). The line on the left marks a ladder of bands corresponding to polyubiquitylated myc‐BNIP3 or myc‐NIX. Data information: Scale bars = 20 μm. Source data are available online for this figure.

Journal: The EMBO Journal

Article Title: FBXL4 suppresses mitophagy by restricting the accumulation of NIX and BNIP3 mitophagy receptors

doi: 10.15252/embj.2022112767

Figure Lengend Snippet: Localisation of FBXL4 variants . FBXL4 KO cells expressing FBXL4‐HA wild‐type or specified variants were fixed and stained for HA (to detect FBXL4 in green) or TOM20 (in magenta). FBXL4 patient‐derived variants exhibit reduced efficiency in mediating the suppression of mitophagy compared to wild‐type FBXL4 . U2OS mt‐Keima cells, U2OS mt‐Keima FBXL4 KO cells and U2OS mt‐Keima FBXL4 KO cells rescued with FBXL4 constructs were analysed by confocal microscopy. The emission signals obtained after excitation with the 458 nm laser (neutral pH) or 561 nm laser (acidic pH) are shown in green and magenta respectively. Quantification of these conditions is shown in Fig . Elevated mitophagy in FBXL4 KO cells expressing FBXL4Arg435* truncation variant is reduced when NIX/BNIP3 are depleted using siRNA . FBXL4 KO cells stably expressing FBXL4Arg435* were transfected with siRNAs targeting both NIX and BNIP3 (NIX/BNIP3 si) or non‐targeting siRNA (NT si). Live‐cell confocal microscopy was performed to visualise mitophagy. Quantification of mitophagy shown in panel (C). Translucent grey dots represent measurements from individual cells. Coloured circles represent the mean ratio from independent experiments ( N = 2). The centre lines and bars represent the mean of the independent replicates ± SD. At least 50 cells were analysed per condition, and over 100 cells were analysed in total per condition. P values were calculated based on the mean values using a one‐way ANOVA (* P < 0.05, ** P < 0.005, *** P < 0.001, **** P < 0.0001). Evaluation of the extent of NIX/BNIP3 depletion in (C, D) using Western blotting. FBXL4Arg435* truncation variant is less efficient than wild‐type FBXL4 at promoting NIX ubiquitylation . Parental, FBXL4 KO cells, FBXL4 KO cells expressing either wild‐type FBXL4 or FBXL4‐Arg435* were transfected with TR‐TUBE and myc‐NIX, as indicated. Cell lysates obtained 48 h post‐transfection were immunoprecipitated with anti‐FLAG antibody, and the immunoprecipitates were analysed by immunoblotting using anti‐myc antibody (to detect ubiquitylated NIX or BNIP3). The line on the left marks a ladder of bands corresponding to polyubiquitylated myc‐BNIP3 or myc‐NIX. Data information: Scale bars = 20 μm. Source data are available online for this figure.

Article Snippet: The pSpCas9 BB‐2A‐Puro (PX459) plasmid backbone was used to create the following guide RNA (gRNA) plasmids (created by Genscript ® ): BNIP3 CRISPR gRNA plasmid (gRNA targeting sequence: TCTTGTGGTGTCTGCGAGCG), NIX CRISPR gRNA plasmid (gRNA targeting sequence: TAGCTCTCAGGTGTGTCGGG) and FBXL4 CRISPR gRNA plasmids (gRNA targeting sequence: CAATTCAAGGCGTACTAATT; gRNA targeting sequence 2: CCCCACAAATCTTATACGAC).

Techniques: Expressing, Staining, Derivative Assay, Construct, Confocal Microscopy, Variant Assay, Stable Transfection, Transfection, Western Blot, Immunoprecipitation

(A) Representative western blots for puromycin and S6K in HEK293T cells after (+ puro) or without (− puro) a pulse of 10 μg/mL puromycin following 3 hours of leucine or arginine limitation, treatment with 250 nM Torin1, or growth in rich medium. Bar graph shows puromycin incorporation relative to rich medium (calculated as described in Methods); error bars represent the standard error of the mean from three technical replicate experiments. (B) Puromycin incorporation in HEK293T cells following 1.5, 3, 6, or 12 hours of leucine or arginine limitation, relative to rich medium. (C) Polysome profiles from HEK293T (WT) cells following 6 hours of leucine or arginine limitation or growth in rich medium. The main plot shows overlaid polysome profiles starting at the disome (2 ribosome) peak and the inset plots show the entire profile, aligned with respect to the monosome peak height along the y-axis and position along the x-axis. (D) Puromycin incorporation in WT or GCN2 KO cell lines following 3 hours of leucine or arginine limitation, relative to rich medium (calculated as in described in Methods, see S5G for representative blots). Error bars represent the standard error of the mean for three technical replicates. (E) Polysome profiles (as described in C) from the GCN2 KO cell line following 6 hours of limitation for leucine or arginine or growth in rich medium.

Journal: Molecular cell

Article Title: Translational control through differential ribosome pausing during amino acid limitation in mammalian cells

doi: 10.1016/j.molcel.2018.06.041

Figure Lengend Snippet: (A) Representative western blots for puromycin and S6K in HEK293T cells after (+ puro) or without (− puro) a pulse of 10 μg/mL puromycin following 3 hours of leucine or arginine limitation, treatment with 250 nM Torin1, or growth in rich medium. Bar graph shows puromycin incorporation relative to rich medium (calculated as described in Methods); error bars represent the standard error of the mean from three technical replicate experiments. (B) Puromycin incorporation in HEK293T cells following 1.5, 3, 6, or 12 hours of leucine or arginine limitation, relative to rich medium. (C) Polysome profiles from HEK293T (WT) cells following 6 hours of leucine or arginine limitation or growth in rich medium. The main plot shows overlaid polysome profiles starting at the disome (2 ribosome) peak and the inset plots show the entire profile, aligned with respect to the monosome peak height along the y-axis and position along the x-axis. (D) Puromycin incorporation in WT or GCN2 KO cell lines following 3 hours of leucine or arginine limitation, relative to rich medium (calculated as in described in Methods, see S5G for representative blots). Error bars represent the standard error of the mean for three technical replicates. (E) Polysome profiles (as described in C) from the GCN2 KO cell line following 6 hours of limitation for leucine or arginine or growth in rich medium.

Article Snippet: pADHS7: pU6-GCN2-1-Cas9-2A-BFP , Cloned from Chu et al., 2015 , Cloned GCN2 (EIF2AK4) guide RNA sequence 2 (Doench et al.2016, Addgene #75876) into pU6-(BbsI)_CBh-Cas9-T2A-BFP.

Techniques: Western Blot

(A) Arginine and leucine YFP codon variant reporter design (see Methods for details). (B-E) Mean YFP fluorescence in the HEK293T (WT) (B,D) or GCN2 KO cell lines (C,E) stably expressing the arginine (B,C) or leucine (D,E) YFP codon variant reporters, following limitation for leucine or arginine with 10 μM trimethoprim (+TMP) for 12, 24, or 48 hours, relative to rich medium +TMP. (F) Premature termination reporter design. A short linker of 8 tandem CUA or UUG leucine codons was added to the YFP-CUA reporter (as shown in A). (G,H) Mean YFP fluorescence in the WT or GCN2 KO cell lines stably expressing the UUG8, CUA8 (G,H) CUA6UUG2, or CUA4UUG4 (H) reporters following limitation for leucine or arginine for 12, 24, or 48 hours without TMP. (I) Western blot for FLAG epitope and GAPDH in the WT or GCN2 KO cell lines stably expressing the UUG8 or CUA8 reporters after growth in rich medium or 48 hours of leucine or arginine limitation. Lane 13 contains lysate from the YFP-WT reporter cell line for a full-length reporter size reference; GAPDH provides an intermediate size reference (see Fig. S6F for overexpressed image).

Journal: Molecular cell

Article Title: Translational control through differential ribosome pausing during amino acid limitation in mammalian cells

doi: 10.1016/j.molcel.2018.06.041

Figure Lengend Snippet: (A) Arginine and leucine YFP codon variant reporter design (see Methods for details). (B-E) Mean YFP fluorescence in the HEK293T (WT) (B,D) or GCN2 KO cell lines (C,E) stably expressing the arginine (B,C) or leucine (D,E) YFP codon variant reporters, following limitation for leucine or arginine with 10 μM trimethoprim (+TMP) for 12, 24, or 48 hours, relative to rich medium +TMP. (F) Premature termination reporter design. A short linker of 8 tandem CUA or UUG leucine codons was added to the YFP-CUA reporter (as shown in A). (G,H) Mean YFP fluorescence in the WT or GCN2 KO cell lines stably expressing the UUG8, CUA8 (G,H) CUA6UUG2, or CUA4UUG4 (H) reporters following limitation for leucine or arginine for 12, 24, or 48 hours without TMP. (I) Western blot for FLAG epitope and GAPDH in the WT or GCN2 KO cell lines stably expressing the UUG8 or CUA8 reporters after growth in rich medium or 48 hours of leucine or arginine limitation. Lane 13 contains lysate from the YFP-WT reporter cell line for a full-length reporter size reference; GAPDH provides an intermediate size reference (see Fig. S6F for overexpressed image).

Article Snippet: pADHS7: pU6-GCN2-1-Cas9-2A-BFP , Cloned from Chu et al., 2015 , Cloned GCN2 (EIF2AK4) guide RNA sequence 2 (Doench et al.2016, Addgene #75876) into pU6-(BbsI)_CBh-Cas9-T2A-BFP.

Techniques: Variant Assay, Fluorescence, Stable Transfection, Expressing, Western Blot, FLAG-tag

(A,B) Representative western blots for phosphorylated and total levels of ribosomal protein S6 kinase 1 (S6K) (A) or eIF2α (B) in HEK293T cells after growth in rich medium or after 3, 6, or 12 hours of leucine or arginine limitation. Bar graph shows percent of protein that is phosphorylated in each condition, relative to the maximum. Error bars represent the standard error of the mean from three technical replicates. (C,D) Heatmap of log2 fold-change (f.c.) in ribosome density for mRNA targets of mTORC1 inhibition (Hsieh et al., 2012) (C) or GCN2 activation via ATF4/CHOP (Han et al., 2013) (D), following 3 hours of leucine or arginine limitation relative to growth in rich medium for HEK293T, HCT116, and HeLa cells. Only targets with a log2 fold change of < 0, for mTORC1 targets, or > 0, for ATF4/CHOP targets, were considered. In HEK293T, HCT116, and HeLa cells, 46/63 (73%), 14/63 (22%), and 45/63 (71%) of mTORC1 targets had higher ribosome density upon arginine than leucine limitation, respectively (C) and 26/40 (65%), 35/40 (88%), and 40/40 (100%) of GCN2 targets had higher ribosome density upon arginine than leucine limitation, respectively (D). (E,F) Box plot of the log2 fold change for each mTORC1 (E) or ATF4/CHOP (F) target upon amino acid limitation (as shown in C,D). A two-sided Wilcoxon signed rank test with continuity correction was performed with μ = 0; the resulting p-value is shown above each comparison (see Methods for details). In HEK293T, HCT116, and HeLa cells, the mTORC1 signaling response was 1.2-, 0.9-, and 1.1-fold higher during limitation for arginine, respectively (E) and the GCN2 signaling response was 1-, 1,2, and 1.5-fold higher during limitation for arginine, respectively (F).

Journal: Molecular cell

Article Title: Translational control through differential ribosome pausing during amino acid limitation in mammalian cells

doi: 10.1016/j.molcel.2018.06.041

Figure Lengend Snippet: (A,B) Representative western blots for phosphorylated and total levels of ribosomal protein S6 kinase 1 (S6K) (A) or eIF2α (B) in HEK293T cells after growth in rich medium or after 3, 6, or 12 hours of leucine or arginine limitation. Bar graph shows percent of protein that is phosphorylated in each condition, relative to the maximum. Error bars represent the standard error of the mean from three technical replicates. (C,D) Heatmap of log2 fold-change (f.c.) in ribosome density for mRNA targets of mTORC1 inhibition (Hsieh et al., 2012) (C) or GCN2 activation via ATF4/CHOP (Han et al., 2013) (D), following 3 hours of leucine or arginine limitation relative to growth in rich medium for HEK293T, HCT116, and HeLa cells. Only targets with a log2 fold change of < 0, for mTORC1 targets, or > 0, for ATF4/CHOP targets, were considered. In HEK293T, HCT116, and HeLa cells, 46/63 (73%), 14/63 (22%), and 45/63 (71%) of mTORC1 targets had higher ribosome density upon arginine than leucine limitation, respectively (C) and 26/40 (65%), 35/40 (88%), and 40/40 (100%) of GCN2 targets had higher ribosome density upon arginine than leucine limitation, respectively (D). (E,F) Box plot of the log2 fold change for each mTORC1 (E) or ATF4/CHOP (F) target upon amino acid limitation (as shown in C,D). A two-sided Wilcoxon signed rank test with continuity correction was performed with μ = 0; the resulting p-value is shown above each comparison (see Methods for details). In HEK293T, HCT116, and HeLa cells, the mTORC1 signaling response was 1.2-, 0.9-, and 1.1-fold higher during limitation for arginine, respectively (E) and the GCN2 signaling response was 1-, 1,2, and 1.5-fold higher during limitation for arginine, respectively (F).

Article Snippet: pADHS7: pU6-GCN2-1-Cas9-2A-BFP , Cloned from Chu et al., 2015 , Cloned GCN2 (EIF2AK4) guide RNA sequence 2 (Doench et al.2016, Addgene #75876) into pU6-(BbsI)_CBh-Cas9-T2A-BFP.

Techniques: Western Blot, Inhibition, Activation Assay, Comparison

(A) Representative western blots for phosphorylated and total S6K in HEK293T cells after growth in rich medium or limitation for leucine or arginine for 3 hours, with or without (n.t.) 250 nM Torin1. Bar graph shows percent of protein that is phosphorylated, relative to the maximum; error bars represent the standard error of the mean from three technical replicates. (B) Changes in codon-specific ribosome density in the hrGFP cell line (as shown in C) after 3 hours of leucine or arginine limitation with 250 nM Torin1, relative to rich medium. (C) Representative western blots for phosphorylated S6K, total S6K, and FLAG after growth in rich medium, or 3 hours of leucine or arginine limitation in HEK293T cells stably expressing either hrGFP, FLAG-RagB-WT (RagB-WT), or FLAG-RagB-Q99L (RagB-Q99L). Bar graph shows percent of protein that is phosphorylated, relative to the maximum in the RagB-Q99L cell line; error bars represent the standard error of the mean from three technical replicates. (D,E) Representative western blots for phosphorylated and total eIF2α (D) or S6K (E) after growth in rich medium, or 3 hours of leucine or arginine limitation in the HEK293T (WT) or GCN2 KO cell lines. Bar graphs show percent of protein that is phosphorylated, relative to the maximum in WT cells; error bars represent the standard error of the mean from three technical replicates. (F) Changes in codon-specific ribosome density for WT, hrGFP, FLAG-RagB-Q99L, and GCN2 KO cell lines following 6 hours of limitation for leucine or arginine, relative to rich medium.

Journal: Molecular cell

Article Title: Translational control through differential ribosome pausing during amino acid limitation in mammalian cells

doi: 10.1016/j.molcel.2018.06.041

Figure Lengend Snippet: (A) Representative western blots for phosphorylated and total S6K in HEK293T cells after growth in rich medium or limitation for leucine or arginine for 3 hours, with or without (n.t.) 250 nM Torin1. Bar graph shows percent of protein that is phosphorylated, relative to the maximum; error bars represent the standard error of the mean from three technical replicates. (B) Changes in codon-specific ribosome density in the hrGFP cell line (as shown in C) after 3 hours of leucine or arginine limitation with 250 nM Torin1, relative to rich medium. (C) Representative western blots for phosphorylated S6K, total S6K, and FLAG after growth in rich medium, or 3 hours of leucine or arginine limitation in HEK293T cells stably expressing either hrGFP, FLAG-RagB-WT (RagB-WT), or FLAG-RagB-Q99L (RagB-Q99L). Bar graph shows percent of protein that is phosphorylated, relative to the maximum in the RagB-Q99L cell line; error bars represent the standard error of the mean from three technical replicates. (D,E) Representative western blots for phosphorylated and total eIF2α (D) or S6K (E) after growth in rich medium, or 3 hours of leucine or arginine limitation in the HEK293T (WT) or GCN2 KO cell lines. Bar graphs show percent of protein that is phosphorylated, relative to the maximum in WT cells; error bars represent the standard error of the mean from three technical replicates. (F) Changes in codon-specific ribosome density for WT, hrGFP, FLAG-RagB-Q99L, and GCN2 KO cell lines following 6 hours of limitation for leucine or arginine, relative to rich medium.

Article Snippet: pADHS7: pU6-GCN2-1-Cas9-2A-BFP , Cloned from Chu et al., 2015 , Cloned GCN2 (EIF2AK4) guide RNA sequence 2 (Doench et al.2016, Addgene #75876) into pU6-(BbsI)_CBh-Cas9-T2A-BFP.

Techniques: Western Blot, Stable Transfection, Expressing

KEY RESOURCES TABLE :

Journal: Molecular cell

Article Title: Translational control through differential ribosome pausing during amino acid limitation in mammalian cells

doi: 10.1016/j.molcel.2018.06.041

Figure Lengend Snippet: KEY RESOURCES TABLE :

Article Snippet: pADHS7: pU6-GCN2-1-Cas9-2A-BFP , Cloned from Chu et al., 2015 , Cloned GCN2 (EIF2AK4) guide RNA sequence 2 (Doench et al.2016, Addgene #75876) into pU6-(BbsI)_CBh-Cas9-T2A-BFP.

Techniques: Recombinant, Staining, Western Blot, Stripping, Hybridization, SYBR Green Assay, Northern Blot, Homologous Recombination, Clone Assay, Sequencing, FLAG-tag, Software

KEY RESOURCES TABLE :

Journal: Molecular cell

Article Title: Translational control through differential ribosome pausing during amino acid limitation in mammalian cells

doi: 10.1016/j.molcel.2018.06.041

Figure Lengend Snippet: KEY RESOURCES TABLE :

Article Snippet: pADHS9: pU6-EEF2K-1-Cas9-2A-BFP , Cloned from Chu et al., 2015 , Cloned EEF2K guide RNA sequence 2 (Doench et al.2016, Addgene #77855) into pU6-(BbsI)_CBh-Cas9-T2A-BFP.

Techniques: Recombinant, Staining, Western Blot, Stripping, Hybridization, SYBR Green Assay, Northern Blot, Homologous Recombination, Clone Assay, Sequencing, FLAG-tag, Software